View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14890_low_2 (Length: 268)
Name: NF14890_low_2
Description: NF14890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14890_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 53053955 - 53053721
Alignment:
| Q |
16 |
atgaatggtaccaaattgacaacatccctagttgcgagagcgagaatatcagcacaagagactttgtttcggcatttaggatccctatcaactgctgcct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53053955 |
atgaatggtaccaaattgacaacatccctagttgcgagagcgagaatatcagcacaagagactttgtttcggcatttaggatccctatcaactgctgcct |
53053856 |
T |
 |
| Q |
116 |
tggccttaaccaccgtgtcaaaaccgtcaccagctagtgatatatcatcaggatgttccctctctgccttcggagttgcaagcaaaatcgaagcatcaca |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53053855 |
tggccttaaccaccgtgtcaaaaccatcaccagctagtgatatatcatcaggatgttccctctctgccttcggagttgcaagcaaaatcgaagcatcaca |
53053756 |
T |
 |
| Q |
216 |
accctataaaagcaagtatctatttagcatataaa |
250 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53053755 |
accctgtaaaagcaagtatctatttagcatataaa |
53053721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University