View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14890_low_3 (Length: 220)
Name: NF14890_low_3
Description: NF14890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14890_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 130 - 205
Target Start/End: Complemental strand, 28053599 - 28053524
Alignment:
| Q |
130 |
tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053599 |
tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg |
28053524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 28053711 - 28053675
Alignment:
| Q |
18 |
aaaagaagatacgtcgtcgtttcgagtttctactaat |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053711 |
aaaagaagatacgtcgtcgtttcgagtttctactaat |
28053675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University