View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14890_low_4 (Length: 214)
Name: NF14890_low_4
Description: NF14890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14890_low_4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 4 - 214
Target Start/End: Original strand, 12529212 - 12529415
Alignment:
| Q |
4 |
gaacttcagcaacagaagcaccgaacaatgacaacagcaggatccgaggaagatagagcaatcttgggtcagaatagtggacatgcaccac-aacatagg |
102 |
Q |
| |
|
||||||||| ||||| || ||| |||||| |||||||| |||||| |||||||||||| |||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12529212 |
gaacttcagtaacagcagaaccaaacaataacaacagccggatccaaggaagatagagtaatcctgggtcagaatagtggacatgcaccacaaacatagg |
12529311 |
T |
|
| Q |
103 |
tggacagttccggtgagaggcgaagttaagtgtaacgtggatgcaccaatcttcaacgacaaaaattgtttttagtgctgctatgtgtgttagaaacgaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
12529312 |
tggacagttccggtgagaggcgaagttaagtgtaacgaggatg-------cttcaacgacaaaaattg-ttttagtgctgctatgtgtgatagaaacgaa |
12529403 |
T |
|
| Q |
203 |
agaggtgaattc |
214 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12529404 |
agaggtgaattc |
12529415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University