View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14890_low_6 (Length: 210)
Name: NF14890_low_6
Description: NF14890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14890_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 9e-63; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 19 - 156
Target Start/End: Original strand, 2821058 - 2821195
Alignment:
| Q |
19 |
ataactgacttgattgtttcttgtgtcaatgcggacagaaatttggttctccacgatacagctcaaagtaaaatatttccactcatcctgcaataatcag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2821058 |
ataactgacttgattgtttcttgtgtcaatgcggacagcaatttggttctccacgatacagctcaaagtaaaatatttcctctcatcctgcaataatcag |
2821157 |
T |
|
| Q |
119 |
caaaaagtggatcccgttcactgagcgactctggcttc |
156 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
2821158 |
caaaaagtggatcccattcactgagcgactgtggcttc |
2821195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 2809778 - 2809828
Alignment:
| Q |
19 |
ataactgacttgattgtttcttgtgtcaatgcggacagaaatttggttctc |
69 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2809778 |
ataactgacttgattgttttttgtgtcaatgcggacagaaatttggttctc |
2809828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 2761638 - 2761705
Alignment:
| Q |
19 |
ataactgacttgattgtttcttgtgtcaatgcggacagaaatttggttctccacgatacagctcaaag |
86 |
Q |
| |
|
||||||||||||||| ||||||||||| || || |||||||||||||||||| ||||||||||||| |
|
|
| T |
2761638 |
ataactgacttgattttttcttgtgtcggtgtggccagaaatttggttctccataatacagctcaaag |
2761705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University