View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14891_low_13 (Length: 256)

Name: NF14891_low_13
Description: NF14891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14891_low_13
NF14891_low_13
[»] chr3 (1 HSPs)
chr3 (18-231)||(303407-303620)


Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 303407 - 303620
Alignment:
18 atattgtctcaaagcatgagtggaagctgctctgaacaagtgaacatgctagtgcaacccttcaatgaaaatgtgaaggctatgttgagcaatctcaaca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
303407 atattgtctcaaagcatgagtggaagctgctctgaacaagtgaacatgctagtgcaacccttcaatgaaaatgtgaaggttatgttgagcaatctcaaca 303506  T
118 ataatctacctggttccagattcatattcattgacagttcccgcatgtttcaggaaattcttttcaatgcaagatcatatggtatgaatctaacataaaa 217  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
303507 ataatctacctggttccagattcattttcattgacagttcccgcatgtttcaggaaattcttttcaatgcaagatcatatggtatgaatctaacataaaa 303606  T
218 tagcatatatcaat 231  Q
    ||||||||||||||    
303607 tagcatatatcaat 303620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University