View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14891_low_17 (Length: 238)
Name: NF14891_low_17
Description: NF14891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14891_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 25554912 - 25555121
Alignment:
| Q |
13 |
gatgaaaacggcgtcgtttgagactgggatttttggggaagaagggtttgagacatggatcggatttgactcagtgccggttaatccgtcgatttcgggt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25554912 |
gatgaaaacggcgtcgtttgagactgggatttttggggaagaagggtttgagacatggatcggatttgactcagtgccggttaatccgtcgatttcgggt |
25555011 |
T |
|
| Q |
113 |
cgggtttgtttgagccaaccgagaacatggtcaaaggagcgattttccattacgattactacgatggttttgattggaccggtgattttgtgttttttgc |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25555012 |
cgggtttgtttcagccaaccgagaacatggtcgaaggagcgattttccattacgattactactatggttttgattgggccggtgattttgtgttttttgc |
25555111 |
T |
|
| Q |
213 |
ggtggagggt |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
25555112 |
ggtggagggt |
25555121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University