View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14892_low_16 (Length: 305)
Name: NF14892_low_16
Description: NF14892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14892_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 161 - 299
Target Start/End: Complemental strand, 1764576 - 1764438
Alignment:
| Q |
161 |
aggcctttctatgtagctccattactaaacctgaaagggtctgtttgaatactaacatactaaactcatccctcgatcttggttcttatgcgtctgattg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1764576 |
aggcctttctatgtagctccattactaaacctgaaagggtatgtttgaatactaacatactaaactcatccctcgatcttggttcttacgcgtctgattg |
1764477 |
T |
|
| Q |
261 |
aaattggttgttgtcggtggcatgtaccctttgcttctc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1764476 |
aaattggttgttgtcggtggcatgtaccctttgattctc |
1764438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 1764737 - 1764625
Alignment:
| Q |
1 |
ctttcacgtcgggggttgagggccaaattcatcgccattgcccccaattcttctatgtaagtgggttg-tttgttttcgtggatatacaaatgtttggct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1764737 |
ctttcacgtcgggggttgagggccaaattcatcgccattgccgccaattcttctatgtaagtgggttgttttgttttcgtggatatacaaatgtttggct |
1764638 |
T |
|
| Q |
100 |
tggtgttattatg |
112 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1764637 |
tggtgttattatg |
1764625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 299
Target Start/End: Complemental strand, 1763710 - 1763602
Alignment:
| Q |
188 |
aacctgaaagggtctgtttgaatactaacatactaaactcatccctcgatcttggttcttatgcgtctgattgaaattggttgttgtcggtggcatgtac |
287 |
Q |
| |
|
|||| ||||||||| | ||||| |||||| || | |||||||| ||||| | |||| ||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
1763710 |
aacccgaaagggtccggttgaacactaacgtattggactcatccgtcgatttaggtttttacgcgtctgattgaaattggttgttgt---tggtatgtac |
1763614 |
T |
|
| Q |
288 |
cctttgcttctc |
299 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
1763613 |
cctttgattctc |
1763602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University