View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14892_low_17 (Length: 273)
Name: NF14892_low_17
Description: NF14892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14892_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 8443856 - 8444084
Alignment:
| Q |
1 |
taacctccataaaaaagcttctttataaggtatctcnnnnnnnnctttcttggtacaatctttatggagaattttatgtaatcattatactcgagttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8443856 |
taacctccataaaaaagcttctttataaggtatcccttttttttctttcttggtacaatctttatggagaattttatgtaatcattatactcgagttcta |
8443955 |
T |
|
| Q |
101 |
gctgaactaaaaattttaaaataaaattgattattttttggtaatgggatannnnnnnaaggataaggggtcattgcttttctttaacaattaacaatgt |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8443956 |
gctgaactaaaaaatttaaaataaaattgattattttttggtaatggaatatttttttaaggataaggggtcattgcttttct-------ttaacaatgt |
8444048 |
T |
|
| Q |
201 |
acaaggaaggaagggataacatgagactttaatgta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8444049 |
acaaggaaggaagggataacatgagactttaatgta |
8444084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University