View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14892_low_19 (Length: 251)

Name: NF14892_low_19
Description: NF14892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14892_low_19
NF14892_low_19
[»] chr1 (2 HSPs)
chr1 (96-158)||(16861786-16861848)
chr1 (1-78)||(16860091-16860171)


Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 96 - 158
Target Start/End: Original strand, 16861786 - 16861848
Alignment:
96 cattttgcattggaggatttgtactcatccatttgttcatgttattagtattatacaaattgt 158  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
16861786 cattttgcattggaggatttgtactcatccatttgttcatgtcattagtattatacaaattgt 16861848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 16860091 - 16860171
Alignment:
1 gtaaaatgattgaccatctctctttacacattcttca----acatcatgcgatttatatctatc-tacttcagatttgagttg 78  Q
    ||||||||||||| |||||||||||  ||||||||||    ||||||||||||||||||||||| || |||||||||||||||    
16860091 gtaaaatgattgatcatctctcttt--acattcttcaacgtacatcatgcgatttatatctatcttatttcagatttgagttg 16860171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University