View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14892_low_19 (Length: 251)
Name: NF14892_low_19
Description: NF14892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14892_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 96 - 158
Target Start/End: Original strand, 16861786 - 16861848
Alignment:
| Q |
96 |
cattttgcattggaggatttgtactcatccatttgttcatgttattagtattatacaaattgt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16861786 |
cattttgcattggaggatttgtactcatccatttgttcatgtcattagtattatacaaattgt |
16861848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 16860091 - 16860171
Alignment:
| Q |
1 |
gtaaaatgattgaccatctctctttacacattcttca----acatcatgcgatttatatctatc-tacttcagatttgagttg |
78 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
16860091 |
gtaaaatgattgatcatctctcttt--acattcttcaacgtacatcatgcgatttatatctatcttatttcagatttgagttg |
16860171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University