View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14892_low_24 (Length: 235)
Name: NF14892_low_24
Description: NF14892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14892_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 8103804 - 8103606
Alignment:
| Q |
18 |
agaccgacacatttcactaatcataacgataaaataaagatatcaatcaatacgccattattaacgtgagcttgtatacctaccagttgacagatcacaa |
117 |
Q |
| |
|
|||| ||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8103804 |
agacggacacgtttcgctaatcataacgataaaataaagatatcaat----acgccattattaacgtgagcttgtatacctaccagttgacagatcacaa |
8103709 |
T |
 |
| Q |
118 |
ataggcattaaccatgcttctgtatataaagatatgtctaagcatcgactaaggctgcaatgaatacatggctgccatccgagtcctctctacagataca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8103708 |
ataggcattaaccatgcttctgtatataaagatatgtctaagcatcgactaaggctgcaatgaaaacatggctgccatccgagtcctctctacagataca |
8103609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University