View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14894_low_3 (Length: 427)
Name: NF14894_low_3
Description: NF14894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14894_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 6e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 31 - 152
Target Start/End: Original strand, 5665282 - 5665403
Alignment:
| Q |
31 |
ttgatgattttggtcttgagcttagacgaattgtagtgtttaatggtgtttcctataatgaacttgaagtggttgttgagaagaaggctggctggctgtg |
130 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||| ||| ||||| ||| |
|
|
| T |
5665282 |
ttgacgattttggtcttgaacttagacgaattgtagtatttatcggtgttttctataatgaacttgaagtggttgttgagaagaagactgactggccgtg |
5665381 |
T |
 |
| Q |
131 |
ttttactcatggatggcgtgaa |
152 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5665382 |
ttttactcatggatggcgtgaa |
5665403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University