View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14895_high_7 (Length: 294)
Name: NF14895_high_7
Description: NF14895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14895_high_7 |
 | |
|
| [»] scaffold0366 (2 HSPs) |
| | |
|
| [»] scaffold0459 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0366 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 90 - 251
Target Start/End: Original strand, 8728 - 8889
Alignment:
| Q |
90 |
agttctaaatcacggtctgcaattgcattgtggcggcagtgtagaggttttaaacgtctctacaacggcaactgtggccgtatcaactgcatttgccaac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8728 |
agttctaaatcacggtctgcaattgcattgtggcggcagtgtagaggttttaaacgtctctacaacggcaactgtggccgtatcaactgcatttgccaac |
8827 |
T |
|
| Q |
190 |
gtcgcaatattaaaattctcaaagtaactgacaatttcaaaccatgaacacacatgcatgaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8828 |
gtcgcaatattaaaattctcaaagtaactgacaatttcaaaccatgaacacacatgcatgaa |
8889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 39
Target Start/End: Original strand, 8644 - 8677
Alignment:
| Q |
6 |
aagaatatatacatagtcggtgccaatatcctgt |
39 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
8644 |
aagaaaatatacatagtcggtgccaatatcctgt |
8677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 90 - 251
Target Start/End: Original strand, 8804 - 8965
Alignment:
| Q |
90 |
agttctaaatcacggtctgcaattgcattgtggcggcagtgtagaggttttaaacgtctctacaacggcaactgtggccgtatcaactgcatttgccaac |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8804 |
agttctaaatcacggtctgcaattgcattgtggcgacagtgtagaggttttaaatgtctctacaacggcaactgtggccgtatcaactgcatttgccaac |
8903 |
T |
|
| Q |
190 |
gtcgcaatattaaaattctcaaagtaactgacaatttcaaaccatgaacacacatgcatgaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8904 |
gtcgcaatattaaaattctcaaagtaactgacaatttcaaaccatgaacacacatgcatgaa |
8965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 39
Target Start/End: Original strand, 8720 - 8753
Alignment:
| Q |
6 |
aagaatatatacatagtcggtgccaatatcctgt |
39 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
8720 |
aagaaaatatacatagtcggtgccaatatcctgt |
8753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University