View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14895_low_12 (Length: 242)
Name: NF14895_low_12
Description: NF14895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14895_low_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 42 - 242
Target Start/End: Original strand, 5714997 - 5715196
Alignment:
| Q |
42 |
aaaaatagttaacgggacaactttgtttcaaataatattatgaaatttataccgatacatcatttttgcaactgtgaacaattaataaatctcactgaca |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5714997 |
aaaaatagttaacgggacaactttgtttcaaataatattatgaaatttatac-gatacatcatttttgcaactgtgaacaattaataaatctcactgaca |
5715095 |
T |
 |
| Q |
142 |
gtataaccttatcagatgttagttgccaaatccacctatatttcaaaccaatctccataaatatgttagataaaaagctcactacattactacactcccc |
241 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5715096 |
gtgtaaccttatcagatgttagttgccaaatcaacctatatttcaaaccaatctccataaatatgttagataaaaagctcactacaatactacactcccc |
5715195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University