View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14895_low_15 (Length: 212)
Name: NF14895_low_15
Description: NF14895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14895_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 9 - 196
Target Start/End: Original strand, 30587099 - 30587286
Alignment:
| Q |
9 |
gaggagcagagaaatgccagatcagaggcaagaaaggaagaactacgcagacaagaaatacaggttgtcttttgagtctttcttctcatcgtgtactatc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30587099 |
gaggtgcagagaaatgccagatcagaggcaagaaaggaagaactacgcagacaagaaatacaggttgtcttttgagtctttcttctcatcgtgtactatc |
30587198 |
T |
 |
| Q |
109 |
tttctacgagggtagattatgtaggggtttcattgaagcagagcaaagttagtcttcttgcactctgttcattggtgggggtggaagc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30587199 |
tttctacgagggtagattatgtaggggtttcattgaagcagagcaaagttagtcttcttgcactctgttcattggtgggggtggaagc |
30587286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University