View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14895_low_8 (Length: 308)
Name: NF14895_low_8
Description: NF14895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14895_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 297
Target Start/End: Complemental strand, 37273827 - 37273547
Alignment:
| Q |
18 |
taatctaagacaatcccaaacaggggggacttaactcattaaaacttgggatccaatagataactcaattagagagaaaatttgaaagatgatgcttgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37273827 |
taatctaagacaatcccaaacaggggggacttaactcattaaaacttgggatccaatagataactcaattagagagaaaatttgaaagatgatgcttgtg |
37273728 |
T |
|
| Q |
118 |
gtacgggaactcaactaagcactctctctttctctttttgtcattcccatgac---nnnnnnnnnatcaatgttaaactattaaaatgtaatgatatgta |
214 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37273727 |
gtacgggaactcaactaagcact--ctctttctctttttgtcattcccatgacttttttttttttatcaatgttaaactattaaaatgtaatgatatgta |
37273630 |
T |
|
| Q |
215 |
gttatgaatagatgatataaaattattcttagaatccatttataatattttttaaagatgttgaattgaaaggatggagtatt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37273629 |
gttatgaatagatgatataaaattattcgtaaaatccatttataatattttttaaagatgttgaattgaaaagatggagtatt |
37273547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University