View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14896_high_16 (Length: 212)
Name: NF14896_high_16
Description: NF14896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14896_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 20388926 - 20388740
Alignment:
| Q |
15 |
atgaaatagatccattcgtgtgaactacagcgaaagggatctttgagtgaaggtacactatttggccattagtcattcacagtcacgtgcacatatctca |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20388926 |
atgaaatagatccattcgtgtgaacaacatcgaaagggatctttgagtgaagatac--tatttggccattagtcattcacagtcacgtgcacatatctca |
20388829 |
T |
 |
| Q |
115 |
cccaaaaataatttccttatctttatataagatgcacaaacactagaacatatgagacttagtaacacttgaaaaatataagtaaatat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20388828 |
cccaaaaataatttccttatctttatataagatgcacaaacactagaacatatgagacttagtaacacttgaaaaatgtaagtaaatat |
20388740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University