View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14896_low_9 (Length: 400)
Name: NF14896_low_9
Description: NF14896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14896_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 16 - 311
Target Start/End: Complemental strand, 34812393 - 34812098
Alignment:
| Q |
16 |
tgatttgtatgtatctaaaataaacaaaaatcaattaacagcaaagcgt-----gggtgaaattgagtattttgcagcagaaattaaattgaaattgata |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34812393 |
tgatttatatgtatctaaaataaacaaaaatcaattaacagcaaagcgaagcgagggtgaaattgagtattttgaagcagaaattaaattgaaattgata |
34812294 |
T |
 |
| Q |
111 |
acatcgagttggtggaacaaacaacaaaaaagaagagaagaaaggtaggtaggtacctggtggggagaagaacgttgaaaaggagaatgaggtaaacatg |
210 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34812293 |
acatcgagttggtggaatgaataacaaaaaagaagagaagaaaggtagataggtacctggtggggagaagaacgttgaaaaggagaatgaggtaaacatg |
34812194 |
T |
 |
| Q |
211 |
gaaaagaggaactactacaactgctatttgtagtgtttgccataactatttatctatctagtctagtctagtataacaatggtggttgtaggttctgttc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||| ||||||||||||||| |
|
|
| T |
34812193 |
gaaaagaggaactactacaactgctatttgtagtgtttgccataactatttatctatc-----tagtatagtataataatggtgattgtaggttctgttc |
34812099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 335 - 383
Target Start/End: Complemental strand, 34812083 - 34812035
Alignment:
| Q |
335 |
caaacaagttgaattaacgccgaaattgaataatcgctgctacgcaaac |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34812083 |
caaacaagttgaattaacgccgaaattgaatagtcgctgctacgcaaac |
34812035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University