View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14898_low_2 (Length: 390)
Name: NF14898_low_2
Description: NF14898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14898_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 57 - 363
Target Start/End: Original strand, 43171129 - 43171430
Alignment:
| Q |
57 |
caacaatgttacccctgattcgcaaatatcctaaatttccattgaaaaaa--tatagaaagaggaaaatagtaaaaccaattggaaggaaatgaaagctg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43171129 |
caacaatgttacccctgattcgcaaatatcctaaatttccattgaaaaaaaatatagaaagaggaaaatagtaaaaccaattggaaggaaatgaaagctg |
43171228 |
T |
 |
| Q |
155 |
attctaatatattagcgagaggcagcagcaataattgcacccaggatggacccaaaactgatggttcaactcgtcgggagtccagcatcacgctgcatgg |
254 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43171229 |
attctaatatattagtaagaggcagcagcaacaattgcacccagtatggacccaaac-------ttcaactcgtcgtgagtccagcatcacgctgcatgg |
43171321 |
T |
 |
| Q |
255 |
tggaaacgccacaagctggcaaaaatgacagttcaactcgtgaatccagcgtcatgctgtatggtggaaacaccaaagccatgtttcataacctcgagcc |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43171322 |
tggaaacgccacaagctggcaaaaatgacagttcaactcgtgaatccagcgtcatgctgtacggtggaaacaccaaagccatgtttcataacctagagcc |
43171421 |
T |
 |
| Q |
355 |
cccacttag |
363 |
Q |
| |
|
||||||||| |
|
|
| T |
43171422 |
cccacttag |
43171430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University