View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1489_high_7 (Length: 233)
Name: NF1489_high_7
Description: NF1489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1489_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 41888215 - 41888020
Alignment:
| Q |
17 |
agattggaaaagagacaaagaatggtatgttagtttaatgatttgtgtgtttttgtaacatacctgcatgcattcattctcttgtannnnnnncttttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41888215 |
agattggaaaagagacaaagaatggtatgttagtttaatgatttgtgtgtttttgtaacatacctgcatgcattcattctcttgtatttttttcttttct |
41888116 |
T |
|
| Q |
117 |
cttctatttgaagtagttgtttgattaggaacttgtatgatgattaatttatgcaccttgcaccagcggtaaggttggagaatcatgaaatgccac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41888115 |
cttctatttgaagtagttgtttgattaggaacttgtatgatgattaatttatgcaccttgcaccagcggtaaggttggagaatcatgaaatgccac |
41888020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University