View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1489_low_10 (Length: 227)
Name: NF1489_low_10
Description: NF1489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1489_low_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 17117465 - 17117237
Alignment:
| Q |
1 |
tttgcttatatttaagtccgacaaattcattaactttttgcttataattgaatatggagtaatacttctacattccaacccaaaatactgaactatatct |
100 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17117465 |
tttgcttatatttaagtcaaaaaaattcattaactttttgcttataattgaatatggagtaatacttctatattccaacccaaaatactgaactatatct |
17117366 |
T |
 |
| Q |
101 |
tggtttttctttt--attgtttatggataacaagcattaaggataaattggatcctttctagtgacataatcttaaaaatgattctagcatgtttgcttt |
198 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17117365 |
tggtttttttttttaattgtttatggataacaagcattaaggataaattggatcctttctagtgacataatcttaaaaatgattctagcatgtttgcttt |
17117266 |
T |
 |
| Q |
199 |
tgcccttacatttgtctgaaattaaatca |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17117265 |
tgcccttacatttgtctgaaattaaatca |
17117237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University