View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1489_low_7 (Length: 249)
Name: NF1489_low_7
Description: NF1489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1489_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 18 - 148
Target Start/End: Original strand, 13685264 - 13685395
Alignment:
| Q |
18 |
taacttaactctaaaattgacttgtaagataaatattgtcgtcacttataaaaacactaacatt-ttttcattttatactcgatatccgctctaaagaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||| ||||||| |
|
|
| T |
13685264 |
taacttaactctaaaattgacttgtaagataaatattgtcgtcacttataaaaacactaacattgttttcattttatattggatatccgctccaaagaac |
13685363 |
T |
 |
| Q |
117 |
agactactctgtataccaatcccaccgacgcc |
148 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| |
|
|
| T |
13685364 |
agactactatgtataccaatcccactgacgcc |
13685395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University