View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1489_low_7 (Length: 249)

Name: NF1489_low_7
Description: NF1489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1489_low_7
NF1489_low_7
[»] chr6 (1 HSPs)
chr6 (18-148)||(13685264-13685395)


Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 18 - 148
Target Start/End: Original strand, 13685264 - 13685395
Alignment:
18 taacttaactctaaaattgacttgtaagataaatattgtcgtcacttataaaaacactaacatt-ttttcattttatactcgatatccgctctaaagaac 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||| |||||||    
13685264 taacttaactctaaaattgacttgtaagataaatattgtcgtcacttataaaaacactaacattgttttcattttatattggatatccgctccaaagaac 13685363  T
117 agactactctgtataccaatcccaccgacgcc 148  Q
    |||||||| |||||||||||||||| ||||||    
13685364 agactactatgtataccaatcccactgacgcc 13685395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University