View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1489_low_8 (Length: 247)
Name: NF1489_low_8
Description: NF1489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1489_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 17117111 - 17116894
Alignment:
| Q |
15 |
tatctagaaatccctttaagcatagattatgcgacactttttagtgctagtacaaatccttacttagttaacatctttgtcaccatattctttttgtttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17117111 |
tatctagaaatccctttaagcatagattatgcgacactttttagtgctagtacaaatccttacttagttaacatctttgtcaccatattctttttgtttg |
17117012 |
T |
 |
| Q |
115 |
tttaatcgacacataatacaaatacaaatgctctcttcacnnnnnnnnnnnnnccattacttctaattaatcaattggggttaacttaggcttaaactaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17117011 |
tttaatcgacacataatacaaatacaaatgctctcttcactttttttgtttttccattacttctaattaatcaattggggttaacttaggcttaaactaa |
17116912 |
T |
 |
| Q |
215 |
gacagaactggattcttg |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
17116911 |
gacagaactggattcttg |
17116894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University