View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14900_low_6 (Length: 242)
Name: NF14900_low_6
Description: NF14900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14900_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 50918931 - 50918702
Alignment:
| Q |
19 |
tggcttacagagatcaatgcgctcatttgctcatccctctcaacaaatgcagacaagctgaattctatcttccatggaagtgcgagaatgaacgccactc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50918931 |
tggcttacagagatcaatgcgctcatttgctcatccctctcaacaaatgcagacaagctgaattctatcttccatggaagtgcgagaatgaacgccactc |
50918832 |
T |
|
| Q |
119 |
ttatgaaaagtgcgagtacgaactcgtcatggagagaatgcttcagatgcagaagatccgcgaaaatcaaaatgctaattccaaacaacccgttaccca- |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50918831 |
ttatgaaaagtgcgagtacgaactcgtcatggagagaatgcttcagatgcagaagatccgcgaaaatcaaaatgctaattccaaacaacccgttacccag |
50918732 |
T |
|
| Q |
218 |
-----gggtgctgctattcctctcatccct |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
50918731 |
ggtcagggtgctgctattcctctcatccct |
50918702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 201 - 238
Target Start/End: Original strand, 29453076 - 29453113
Alignment:
| Q |
201 |
aaacaacccgttacccagggtgctgctattcctctcat |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29453076 |
aaacaacccgttactcagggtgctgctattcctctcat |
29453113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University