View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14902_high_1 (Length: 252)
Name: NF14902_high_1
Description: NF14902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14902_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 4203203 - 4203378
Alignment:
| Q |
1 |
tttttggaagattcactacttcaggacacatcctaaggttccaaaaattgttattgttactaggattttcttgaacttcattgttttgagattgttgttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203203 |
tttttggaagattcactacttcaggacacatcctaagattccaaaaattgttattgttactaggattttcttgaacttcattgttttgagattgttgttg |
4203302 |
T |
|
| Q |
101 |
tggcatgcaaggtgtagcagtgagaagtggaaaaatgccaaaaccaacacttaaggaagctgatgaaggtaaagag |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4203303 |
tggcatgcaaggtgtagcagtgagaagtggaaaaatgccaaaaccaacacttaatgaagctgatgaaggtaaagag |
4203378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University