View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14902_low_4 (Length: 233)
Name: NF14902_low_4
Description: NF14902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14902_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 10 - 193
Target Start/End: Original strand, 5673812 - 5673995
Alignment:
| Q |
10 |
aacaaaggactgggagttcataaaattcgtgaatttaatttgtcattgttagataaatggtgttagaggatgtttatggatcaaggaagtctgtggtata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5673812 |
aacaaaggactgggagttcataaaattcgggaatttaatttgtcattgttagataaatggtgttagaggatgtttttggatcaaggaagtctgtggtata |
5673911 |
T |
 |
| Q |
110 |
agatgttagtagctaggtatggaagaaaggtggttatattaggtaggtggtcggttacgatcattgtggggggaagcaaatgat |
193 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5673912 |
agatatcagtagctaggtatggaagaaaggtggttatattaggtaggtggtcggttacgatcattgtggggggaagcaaatgat |
5673995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 10 - 193
Target Start/End: Original strand, 5698864 - 5699047
Alignment:
| Q |
10 |
aacaaaggactgggagttcataaaattcgtgaatttaatttgtcattgttagataaatggtgttagaggatgtttatggatcaaggaagtctgtggtata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5698864 |
aacaaaggactgggagttcataaaattcgggaatttaatttgtcattgttagataaatggtgttagaggatgtttttggatcaaggaagtctgtggtata |
5698963 |
T |
 |
| Q |
110 |
agatgttagtagctaggtatggaagaaaggtggttatattaggtaggtggtcggttacgatcattgtggggggaagcaaatgat |
193 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5698964 |
agatatcagtagctaggtatggaagaaaggtggttatattaggtaggtggtcggttacgatcattgtggggggaagcaaatgat |
5699047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 81
Target Start/End: Original strand, 44958 - 45014
Alignment:
| Q |
25 |
gttcataaaattcgtgaatttaatttgtcattgttagataaatggtgttagaggatg |
81 |
Q |
| |
|
||||||| |||| | ||||||||||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
44958 |
gttcatagaatttgagaatttaatttaacattgttaggtaagtggtgttagaggatg |
45014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University