View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14902_low_5 (Length: 227)
Name: NF14902_low_5
Description: NF14902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14902_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 9 - 217
Target Start/End: Complemental strand, 25587463 - 25587251
Alignment:
| Q |
9 |
tcttcttcttccacagcttcttgctacggttgctttggatcttgttttccttaaagggctaaactaatcttatcttcatcagtgttaccaactaactgta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25587463 |
tcttcttcttccacagcttcttgctacggttgctttggatcttgttttccttaaaggactaaactaatcttatcttcatcagtgttaccaactaactgta |
25587364 |
T |
 |
| Q |
109 |
ttaagaagacatgcc----ctcctgtcccccctcgtgtcaacacggattgtctgtttttgagcgggaaagaaaggcctttcctcactgccattttacact |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25587363 |
ttaagaagacatgccctccctcctgtcccccctcgtgtcaacacggattgtctgtttttgagcgggaaagaaaggcctttcctcactgccattttacact |
25587264 |
T |
 |
| Q |
205 |
atttaattcattt |
217 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25587263 |
atttaattcattt |
25587251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University