View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14903_high_10 (Length: 255)
Name: NF14903_high_10
Description: NF14903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14903_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 237
Target Start/End: Original strand, 19152239 - 19152465
Alignment:
| Q |
11 |
cagagaagaattgcaatggaagcagccaaaggaactgatttttgaagaatattgtaagaatgatgagaagataaggagcaagaaaactttgtgtcatttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19152239 |
cagagaagaattgcaatggaagcagctaaaggaactgatttttgaagaatattgtaagaatgatgagaagataaggagcaagaaaactttgtgtcatttt |
19152338 |
T |
 |
| Q |
111 |
ttgttattcctaactgaaccttcttttgaggtgtgttgagtttttcacagaaggtggaaatctgaatgaaagatggtaatgaagaggaacccatgatgat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19152339 |
ttgttattcctaactgaaccttcttttgaggggtgctgagtttttcacagaaggtggaaatctgaatgaaagatggtaatgaagaggaacccatgatgat |
19152438 |
T |
 |
| Q |
211 |
gatgattggtttggcctcccctctcta |
237 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
19152439 |
gatgattggtttggcttcccctctcta |
19152465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University