View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14903_low_13 (Length: 253)
Name: NF14903_low_13
Description: NF14903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14903_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 39541469 - 39541571
Alignment:
| Q |
151 |
gatgatgatgtgattttctcttcaatgatttgcaagcatttgtactctacatgcatgcatgtttatgctttcttcttttgattattctccaaggctatgt |
250 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
39541469 |
gatgatgatgggattttctcttcaatgatttgcaagcatttgtactctacatgcatgcatgtttatgctttcttctgttgatcatgctccaaggctatgt |
39541568 |
T |
|
| Q |
251 |
gat |
253 |
Q |
| |
|
||| |
|
|
| T |
39541569 |
gat |
39541571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University