View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14904_high_23 (Length: 221)
Name: NF14904_high_23
Description: NF14904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14904_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 5364924 - 5365107
Alignment:
| Q |
18 |
tgtttaagagtggggatccggcgaaaagagcgagggcgattgttcaagctgttactcattacagtgatcctgagattttggctgaggttagttgtggatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5364924 |
tgtttaagagtggggatccggcgaaaagagcgagggcgattgttcaagctgttactcattacagtgatccagagattttggctgaggttagttgtggatt |
5365023 |
T |
 |
| Q |
118 |
gggtgaagccatggttgggcttaatttgactgatcataatgttgaaaggtttgctaataggtctgaatgatttcattatcatcg |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5365024 |
gggtgaagctatggttgggcttaatttgactgatcataatgttgaaaggtttgctaataggtctgaatgatttcattatcatcg |
5365107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University