View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14904_high_25 (Length: 207)
Name: NF14904_high_25
Description: NF14904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14904_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 158
Target Start/End: Original strand, 38822772 - 38822912
Alignment:
| Q |
18 |
gcatagggagacatgataaaagtaaatggtgaaagaggaagagaagaaggtgagtgaaaatggaaggtttttgtggaggaaaaagtgtgcatttgggagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38822772 |
gcatagggagacatgataaaagtaaatggtgaaagaggaagagaagaaggtgagtgaaaatggaaggtttttatggaggaaaaagtgtgcatttgggagt |
38822871 |
T |
|
| Q |
118 |
gagaatgggaagtaaaagagaaggagaatagtgatggaatt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38822872 |
gagaatgggaagtaaaagagaaggagaatagtgatggaatt |
38822912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 37 - 145
Target Start/End: Original strand, 38817184 - 38817289
Alignment:
| Q |
37 |
aagtaaatggtgaaagaggaagagaagaaggtgagtgaaaatggaaggtttttgtggaggaaaaagtgtgcatttgggagtgagaatgggaagtaaaaga |
136 |
Q |
| |
|
||||||| ||||||||||||||||||| || ||||||||||||||| |||| || ||||||||||||| |||| ||| |||||||| |||| |||||| |
|
|
| T |
38817184 |
aagtaaagggtgaaagaggaagagaaggag---agtgaaaatggaagggttttttgtaggaaaaagtgtggattttggaatgagaatgtgaaggaaaaga |
38817280 |
T |
|
| Q |
137 |
gaaggagaa |
145 |
Q |
| |
|
||| ||||| |
|
|
| T |
38817281 |
gaaagagaa |
38817289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University