View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14904_low_15 (Length: 372)
Name: NF14904_low_15
Description: NF14904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14904_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 15 - 363
Target Start/End: Complemental strand, 52386273 - 52385925
Alignment:
| Q |
15 |
ataattttgttacagaatcccgttatcctttctaacatctccgcagctgactttgcagccatgacgacgaggtttatcaggattgtcaggatcagaatca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386273 |
ataattttgttacagaatcccgttatcctttctaacatctccgcagctgactttgcagccatgacgacgaggtttatcaggattgtcaggatcagaatca |
52386174 |
T |
|
| Q |
115 |
cttggttccaccagaagtcctctcaggcatcgtcttcgaaccattggttggtaagttaacctctctacccggctaactgttttaacttcagctttgcggt |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52386173 |
cttggttccaacagaagtcctctcaggcatcgtcttcgaaccattggttggtaagttaacctctctacccggctaactgttttaacttcagcttcgcggt |
52386074 |
T |
|
| Q |
215 |
tttccaaaccttgtttaacttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaatt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386073 |
tttccaaaccttgtttaacttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaatt |
52385974 |
T |
|
| Q |
315 |
attcatactctgtatgttgctgttcacatatgcctttcccgcttcatct |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52385973 |
attcatactctgtatgttgctgttcacatatgcctttcccgcttcatct |
52385925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 347
Target Start/End: Complemental strand, 7087895 - 7087813
Alignment:
| Q |
265 |
tgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgc |
347 |
Q |
| |
|
||||| || ||||||||| |||| |||||||| || | ||| | ||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
7087895 |
tgaactccagggtctctttcattgattgaaccatgaaacatgagtgaattattgatactttgtatgttgctgttaacatatgc |
7087813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University