View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14904_low_16 (Length: 371)
Name: NF14904_low_16
Description: NF14904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14904_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 308
Target Start/End: Complemental strand, 5420525 - 5420230
Alignment:
| Q |
11 |
agataattctagagcaaaagagattattcaaattcaacagttaggttcatattgctgtataatatagaagttgtagaggtctctaaaactgcacggtaat |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5420525 |
agattattctagagcaaaagagattattcaa------cagttaggttcatattgctgtataatatagaagttgtagaggtctctaaaactgcacggtaat |
5420432 |
T |
 |
| Q |
111 |
tgcaattttagccgtattggatgcattttgccgcgatataattgtccaaaatgtc----actaggccgtaatctcaatttagaattatggttactggtta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
5420431 |
tgcaattttagccgtattggatgcattttgccgcgatataattgtccaaaatgtctgtcactaggccgtaatcacaatttagaattatggttgctggtta |
5420332 |
T |
 |
| Q |
207 |
tgcttacaaatatgcagattaaatcacactcaagtatagaaaatacagcaatgcaaacaaaatgcttgctgacaaagataccaagtctatctttaaaggg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
5420331 |
tgcttacaaatatgcagattaaatcacactcaagtatagaaaatacagcaatgcaaacaaaatgcttgctgtcaaagataccaattctatctttaaaggg |
5420232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University