View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14904_low_17 (Length: 366)
Name: NF14904_low_17
Description: NF14904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14904_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 351
Target Start/End: Complemental strand, 6946114 - 6945782
Alignment:
| Q |
19 |
gggagttgattcggaaggtgggtaatggcttggaaacttacttttggaaggatgcgtggattactagtgggccttttatggannnnnnnnccgcgccttc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||| |
|
|
| T |
6946114 |
gggagttgattcggaaggtgggtaatggcttggaaacttacttttggaaggatgcgtggattactagtgtgccttttatggattttttttctgcgccttt |
6946015 |
T |
|
| Q |
119 |
tcaccttagcaaattgtcaagatgtgaaggtggtggaggtgtgggaaaggaatgcggttggagagagatgggggcttcgttggtgtagagacttgtttgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6946014 |
tcaccttagcaaattgtcaagatgtgaaggtggtggaggtgtgggaaaggaatgcggttggagagagatgggggcttcgttggtgtagagacttgtttgt |
6945915 |
T |
|
| Q |
219 |
gtgggaaagggagcttgtgaatgctcttataacaaggggtggtggtaagggagggagtggattcgaggtcttggaagccggaggagggatgggtttttac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6945914 |
gtgggaaagggagcttgtgaatgctcttataacaaggggtggtggtaagggagggagtggattcgaggtcttggaagccggaggagggatgggtttttac |
6945815 |
T |
|
| Q |
319 |
cgtcaagtcttgttatttattgttacaagatag |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6945814 |
cgtcaagtcttgttatttattgttacaagatag |
6945782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University