View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14904_low_18 (Length: 352)
Name: NF14904_low_18
Description: NF14904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14904_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 25771481 - 25771322
Alignment:
| Q |
1 |
ttgttaagccgcctcaggttaccagcttcacaagtttatgcgactctcactgtcacccagtgcccctcgaacagcaaagtgttaaactacggttccatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| | | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25771481 |
ttgttaagccgcctcaggttaccatcttcacaagtttatgcgactcacactgtcacccaattctcctcgaacagcaaagtgttaaactacggttccatgt |
25771382 |
T |
 |
| Q |
101 |
gtttaagcaacctctaggatacctccactaaagatacacgaagctactatccacaatttt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25771381 |
gtttaagcaacctctaggatacctccactaaagatacacgaagctactatccacaatttt |
25771322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 80 - 137
Target Start/End: Complemental strand, 5542937 - 5542879
Alignment:
| Q |
80 |
tgttaaactacggttccatgtgttt-aagcaacctctaggatacctccactaaagatac |
137 |
Q |
| |
|
|||||||||||| || ||||||||| |||||||||||| |||| ||| ||||||||||| |
|
|
| T |
5542937 |
tgttaaactacgatttcatgtgttttaagcaacctctaagataactcgactaaagatac |
5542879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University