View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14904_low_21 (Length: 251)
Name: NF14904_low_21
Description: NF14904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14904_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 228
Target Start/End: Complemental strand, 21313068 - 21312844
Alignment:
| Q |
4 |
ttccttagttctctttctctagcaaattgctgctatgatggttagctaatgcaaaagtgtatatacaaatcaactccaagaattaaaatggttaaaactc |
103 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
21313068 |
ttccttagttctctttctctatcaaattgctgctatgattgttagctaatgcaaaagtgtatatacaaatgaactccaagaattaaaatggttaaaaatc |
21312969 |
T |
|
| Q |
104 |
taaacatatggttacactcttcaagtataaaccgaagaaaagtgcccctttggattggagtgattgaggtacttcagatcttccattacatgttcccaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21312968 |
taaacatatggttacactcttcaagtataaaccgaagaaaagtgcccctttggattggagtgattgaggtacttcagatcttccattacatgttcccaat |
21312869 |
T |
|
| Q |
204 |
tgaaatcgtgtggcatttctctgat |
228 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
21312868 |
tgaaatagtgtggcatttctctgat |
21312844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University