View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14905_high_4 (Length: 307)
Name: NF14905_high_4
Description: NF14905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14905_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 50605043 - 50604755
Alignment:
| Q |
1 |
atatttccaactgtcctcttctct-----tctcctctcaaacacgctcactgctgaatgctgatctctaaaaataaactcatgcatgtttttctttgtga |
95 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50605043 |
atatttccaactgtcctcttctcttctcttctcctctcaaacacgctcactgctgaatgctgatctctaaaaataaactcatgcatgtttttctttgtga |
50604944 |
T |
 |
| Q |
96 |
tacggtaacatggtttttgaccacttggttactgctttttctttttcaccttattggccattacctatttcaatctcgttgatctgcaca-ggggtctta |
194 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50604943 |
tacggtaacatggtttt-----------ttactgctttttcttttacaccttattggccattacctatttcaatctcgttgatctgcacagggggtctta |
50604855 |
T |
 |
| Q |
195 |
cactctagtaagctgcttctgtcgtatttattaatgtcttcccctgataagcattaatgtctctaccaaccaatgttctctaactgaactctactattct |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50604854 |
cactctagtaagctgcttctgtcgtatttattaatgtcttccactgataagcattaatgtctctaccaaccaatgttctctaactgaactctactattct |
50604755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University