View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14906_low_10 (Length: 249)

Name: NF14906_low_10
Description: NF14906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14906_low_10
NF14906_low_10
[»] chr5 (5 HSPs)
chr5 (1-198)||(38448882-38449079)
chr5 (75-198)||(38440567-38440691)
chr5 (31-80)||(38440418-38440467)
chr5 (205-241)||(38449112-38449148)
chr5 (209-241)||(38440729-38440761)


Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 38448882 - 38449079
Alignment:
1 aaattgttacgttcagcatatgtttcagaacttctctcaaaacaatgagagattcttctctgaagttagggacagtatctgctactaaaaggttgaactt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38448882 aaattgttacgttcagcatatgtttcagaacttctctcaaaacaatgagagattcttctctgaagttagggacagtatctgctactaaaaggttgaactt 38448981  T
101 gataggacctttggtgcagcattgttgcaatatcaagttgctcctattgctgaagttatattagaaaaattgatgaatcgagatgttgaggaagcatg 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
38448982 gataggacctttggtgcagcattgttgcaatatcaagttgctcctattgctgaagttatattagaaaaatggatgaatcgagatgttgaggaagcatg 38449079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 75 - 198
Target Start/End: Original strand, 38440567 - 38440691
Alignment:
75 gtatctgctactaaaaggttgaacttgataggacct-ttggtgcagcattgttgcaatatcaagttgctcctattgctgaagttatattagaaaaattga 173  Q
    ||||||||| ||| |||||||||||||||||||||  |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||    
38440567 gtatctgctgctacaaggttgaacttgataggaccccttggtgcagcattgttgcaacatcaagttgctcctattgctgaagttatattagaaaaatgga 38440666  T
174 tgaatcgagatgttgaggaagcatg 198  Q
    ||||||| |||||||||||||||||    
38440667 tgaatcgtgatgttgaggaagcatg 38440691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 38440418 - 38440467
Alignment:
31 cttctctcaaaacaatgagagattcttctctgaagttagggacagtatct 80  Q
    ||||||||||||||||||||||||||||| ||||||||||||| ||||||    
38440418 cttctctcaaaacaatgagagattcttctatgaagttagggactgtatct 38440467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 38449112 - 38449148
Alignment:
205 ttgccatggttacttgttttcaagactgttttcatct 241  Q
    |||||||||||||||||||||||||||||||||||||    
38449112 ttgccatggttacttgttttcaagactgttttcatct 38449148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 38440729 - 38440761
Alignment:
209 catggttacttgttttcaagactgttttcatct 241  Q
    ||||||||||||||||||||| |||||||||||    
38440729 catggttacttgttttcaagattgttttcatct 38440761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University