View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14907_high_20 (Length: 239)
Name: NF14907_high_20
Description: NF14907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14907_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 32953450 - 32953237
Alignment:
| Q |
15 |
caaaggagtaacggagctgtaaataaaaaggaggtgatgactaggatctggaaatttgtgttcnnnnnnngcagctgtaatggttggtcagtcgcgacca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32953450 |
caaaggagtaacggagctgtaaataaaaaggaggtgatgactaggatctggaaatttgtgttctttttttgcagctgtaatggttggtcagtcgcgacca |
32953351 |
T |
 |
| Q |
115 |
aaacatcgtgccatggccgtaaggatgttcctgttatttttcttcccactgttaaaacggccaataacat-------gcctccgttatggatggtcacta |
207 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
32953350 |
aaacatcgtgccgtggccgtaaggatgttcctgttatttttcttcccactgttaaaacggccaataacataatcgccgcctgcgttatggatggtcacta |
32953251 |
T |
 |
| Q |
208 |
ttgcactgcgatat |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32953250 |
ttgcactgcgatat |
32953237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 70
Target Start/End: Original strand, 7805849 - 7805902
Alignment:
| Q |
17 |
aaggagtaacggagctgtaaataaaaaggaggtgatgactaggatctggaaatt |
70 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
7805849 |
aaggagtaacaaagctgtaaataaagaggaggtgatgacaaagatctggaaatt |
7805902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University