View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14907_low_17 (Length: 276)
Name: NF14907_low_17
Description: NF14907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14907_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 169
Target Start/End: Complemental strand, 17227670 - 17227515
Alignment:
| Q |
14 |
gaagtagtagtagtagtaagataacatggggttgcgtggtgtgactgacacaaagaggtcccacatcgtaggccgataaacaagcacaattttcttaagc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17227670 |
gaagaagtagtagtagtaagataacatggggttgcgtggtgtgactgacacaaagaggtcccacatcgtaggccgataaacaagcacaattttcttaagc |
17227571 |
T |
 |
| Q |
114 |
cacttgaacactaaccccagttaggggacacattcagaaaggacagtatggcctaa |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17227570 |
cacttgaacactaaccccagttaggggacacattcagaaaggacagtatggcctaa |
17227515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 216 - 268
Target Start/End: Complemental strand, 17227476 - 17227424
Alignment:
| Q |
216 |
attaataacacccatagcccacttctttctcccatgcacttgtcctcttcatt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17227476 |
attaataacacccatagcccacttctttctcccatgcacttgtcctcttcatt |
17227424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University