View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14907_low_26 (Length: 206)
Name: NF14907_low_26
Description: NF14907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14907_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 190
Target Start/End: Original strand, 33188241 - 33188415
Alignment:
| Q |
16 |
atttgtatacacacgagtgtggatatctcgattttacccatatgatgtgatgatcagatgaccgttggatcagatggacgattcataggtgctctaaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33188241 |
atttgtatacacacgagtgtggatatctcgattttacccatatgatgtgatgatcagatgaccgttggatcagatggacgattcataggtgctctaaaca |
33188340 |
T |
 |
| Q |
116 |
tatgatgtcatgtgtcaagtttctccataggtgtaagtggattattgtatcatgtggatgccttattgagccttt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33188341 |
tatgatgtcatgtgtcaagtttctccataggtgtaagtggattattgtatcatgtggatgccttattgagccttt |
33188415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University