View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_high_27 (Length: 308)
Name: NF1490_high_27
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 119 - 301
Target Start/End: Original strand, 410600 - 410782
Alignment:
| Q |
119 |
atttgaaattaatgatttatctgttaaccattcaaatgacatttctattttgtttgaacttggagcaggcagctcttgatgtgttcactgaggagcctcc |
218 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410600 |
atttgaaattaattagttatctgttaaccattcaaatgacatttctattttgtttgaacttggagcaggcagctcttgatgtgttcactgaggagcctcc |
410699 |
T |
 |
| Q |
219 |
agccaaagacagtaagttagtgcaacatgagaatgtgattgccactcctcatcttggagccagcaccaaagaagcacaggttt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410700 |
agccaaagacagtaagttagtgcaacatgagaatgtgattgctactcctcatcttggagccagcaccaaagaagcacaggttt |
410782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 13 - 95
Target Start/End: Original strand, 410448 - 410530
Alignment:
| Q |
13 |
atcatcaatgttgctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410448 |
atcatcaatgttgctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa |
410530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University