View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_high_57 (Length: 215)
Name: NF1490_high_57
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_high_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 250618 - 250443
Alignment:
| Q |
19 |
gtcgaatagttgcgatatcagattcaaaaggtcgtttggaagttcagaccaatctaccggcatcatcgccatggatgatgcttgctgaattgctgattct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
250618 |
gtcgaatagttgcgatatcagattcaaaaggtcgtttggaagttcagaccaatctaccggcatcatcgctatggatgatgcttgctgaattgccgattct |
250519 |
T |
|
| Q |
119 |
cttttctttttcttcatcttcagagtaagggatagactagggttagtggtttcacgctttctccgtcgggtcagtc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
250518 |
cttttctttttcttcatcttcagagtaagggatagactagggttagtggtttcacgctttctctatcgggtcagtc |
250443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 44679913 - 44679858
Alignment:
| Q |
21 |
cgaatagttgcgatatcagattcaaaaggtcgtttggaagttcagaccaatctacc |
76 |
Q |
| |
|
|||||||||||||||||||||| | ||| || |||||||||||||||||||||||| |
|
|
| T |
44679913 |
cgaatagttgcgatatcagattgacaagatcatttggaagttcagaccaatctacc |
44679858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 44687997 - 44687941
Alignment:
| Q |
20 |
tcgaatagttgcgatatcagattcaaaaggtcgtttggaagttcagaccaatctacc |
76 |
Q |
| |
|
||||||||||||||||||||||| | ||| || ||||||||||||||||||||||| |
|
|
| T |
44687997 |
tcgaatagttgcgatatcagattgacaagatcagttggaagttcagaccaatctacc |
44687941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University