View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1490_high_57 (Length: 215)

Name: NF1490_high_57
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1490_high_57
NF1490_high_57
[»] chr1 (1 HSPs)
chr1 (19-194)||(250443-250618)
[»] chr8 (2 HSPs)
chr8 (21-76)||(44679858-44679913)
chr8 (20-76)||(44687941-44687997)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 250618 - 250443
Alignment:
19 gtcgaatagttgcgatatcagattcaaaaggtcgtttggaagttcagaccaatctaccggcatcatcgccatggatgatgcttgctgaattgctgattct 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||    
250618 gtcgaatagttgcgatatcagattcaaaaggtcgtttggaagttcagaccaatctaccggcatcatcgctatggatgatgcttgctgaattgccgattct 250519  T
119 cttttctttttcttcatcttcagagtaagggatagactagggttagtggtttcacgctttctccgtcgggtcagtc 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||    
250518 cttttctttttcttcatcttcagagtaagggatagactagggttagtggtttcacgctttctctatcgggtcagtc 250443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 44679913 - 44679858
Alignment:
21 cgaatagttgcgatatcagattcaaaaggtcgtttggaagttcagaccaatctacc 76  Q
    |||||||||||||||||||||| | ||| || ||||||||||||||||||||||||    
44679913 cgaatagttgcgatatcagattgacaagatcatttggaagttcagaccaatctacc 44679858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 76
Target Start/End: Complemental strand, 44687997 - 44687941
Alignment:
20 tcgaatagttgcgatatcagattcaaaaggtcgtttggaagttcagaccaatctacc 76  Q
    ||||||||||||||||||||||| | ||| ||  |||||||||||||||||||||||    
44687997 tcgaatagttgcgatatcagattgacaagatcagttggaagttcagaccaatctacc 44687941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University