View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_15 (Length: 414)
Name: NF1490_low_15
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 6 - 408
Target Start/End: Complemental strand, 28094104 - 28093702
Alignment:
| Q |
6 |
tttgtgctgccgcttcttctagagattcttaggaaaaggactaacattgtattactttgatttgatctttgtgtgttaaatgtaaggtaatatgggatga |
105 |
Q |
| |
|
|||||| ||| | |||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
28094104 |
tttgtggtgctggttcttctagagaatcttaggaaaaggactaacattgtattgctttgatttgatttttgtgtgttgtatgtaaggtaatatgggatga |
28094005 |
T |
 |
| Q |
106 |
acttggagaatcggattcgcaaaaggatgcactgttgctcgcaatagaacaaatgtgtctggatttgtataagaaaaaagtggacgaagctaaactgcat |
205 |
Q |
| |
|
||| |||||||| ||||| || ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28094004 |
actcggagaatcagattctcataaggatgcaatgttgctcgaaatagaacaaatgtgtctggatttgtataagaaaaaagtggatgaagctaaactgcat |
28093905 |
T |
 |
| Q |
206 |
aaggcacaacttcagcatcaaattgctgattatgaagaagaaattgctggcatttgtgctgcaattggtgaacagtcaccacttgtaagtcttgttggca |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28093904 |
aaggcacaacttcagcatcaaattgctgattatgaagaagaaattgctggcatttgtgctgcaattggtgaacaatcaccacttgtaagtcttgttggca |
28093805 |
T |
 |
| Q |
306 |
ttctacatttgagtttatgatttagccattctattggtcagagctgaggcggaaatttttcatctaacaaacttccactgttgtgtccgtagtttgagcc |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||| ||||||| ||| |||||| ||||||||||| |
|
|
| T |
28093804 |
ttctacatttgagtttatgatttagccattctcttggccagagctgaggcggaaatttttcaactaacatacttccattgtcgtgtccttagtttgagcc |
28093705 |
T |
 |
| Q |
406 |
taa |
408 |
Q |
| |
|
||| |
|
|
| T |
28093704 |
taa |
28093702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University