View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_25 (Length: 312)
Name: NF1490_low_25
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 1810299 - 1810215
Alignment:
| Q |
86 |
gccggtgggggtcattggtttgggcgggaagagaaatgaatcactttctatctatggcgcggtttctctctactcaactcataat |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1810299 |
gccggtgggggtcattggtttgggcgggaagagaaattaatcactttctatctatggcgcggtttctctctactcaactcataat |
1810215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 1810344 - 1810292
Alignment:
| Q |
20 |
aaggaggaaagtagccatcagattcttccagtatccttcatcatcgccggtgg |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1810344 |
aaggaggaaagtagccatcagattcttccagtatccttcatcatcgccggtgg |
1810292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University