View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_26 (Length: 311)
Name: NF1490_low_26
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 33597177 - 33597471
Alignment:
| Q |
1 |
ggaggatgaaagataaggcgggaggtccctgnnnnnnnnnnnnnncttgcgtataaagttaagcctgaaagttatataatcattgcaatgcgatatcctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33597177 |
ggaggatgaaagataaggcgggaggtccctgaaaaaaaacaaaaacttgcgtataaagttaagcctgaaagttatataatcattgcaatgcgatatcctt |
33597276 |
T |
 |
| Q |
101 |
acaaattattgcgacaattaattttgacttatgactcaaaatcaaatcagttttagagtatttgtttgtcaatggtaacatccaccataaattcaagtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33597277 |
acaaattattgcgacaattaattttgacttatgactcaaaatcaaatcagttttagagtatttgtttgtcaatggtaacatccaccataaattcaagtat |
33597376 |
T |
 |
| Q |
201 |
tttcaccatacataaattcagttttgatgannnnnnnncatgaaactttttgtaaggacatgcggcaacaaaatcaataaatcaactataatttg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33597377 |
tttcaccatacataaattcagttttgatgattttttttcatgaaactttttgtaaggacatgcggcaacaaaatcaataaatcaacgataatttg |
33597471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University