View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_35 (Length: 280)
Name: NF1490_low_35
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_35 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 124 - 280
Target Start/End: Complemental strand, 4475016 - 4474861
Alignment:
| Q |
124 |
gtgtattatccaccgttaagaccccttgcatgatttaattgactcacatttatgtagaatacgagttgcatcttgctttatcaaatatttattgccacta |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4475016 |
gtgttttatccaccgttaagaccccttgcatgatttaattgactcacatttatgtagaatacgagttgcatcttgctttatcaaatatttattgccacta |
4474917 |
T |
 |
| Q |
224 |
aaaattaatatattatattgagttgtatatttctttctcaaagttggcaccacatat |
280 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474916 |
aaaatt-atatattatattgagttgtatatttctttctcaaagttggcaccacatat |
4474861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 4475163 - 4475124
Alignment:
| Q |
18 |
taaggaaaaactaaatttagtgacatgaattaagggaaag |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4475163 |
taaggaaaaactaaatttagtgacatgaattaagggaaag |
4475124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University