View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_43 (Length: 253)
Name: NF1490_low_43
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_43 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 27602100 - 27601866
Alignment:
| Q |
19 |
gcaggttcatctcaatctttttgcaatttgcattatgtttttaggagaatttgtcataaatatctgaccgatttttatgtggctgaaataagggaagatg |
118 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27602100 |
gcaggttcatcttaatcttttcgcaatttgcattatgtttttaggagaatttgtcataaatgtctgaccgatttttatgtggctgaaataagggaagatg |
27602001 |
T |
|
| Q |
119 |
atcttaggtgttcttgtgtgaattattttcattttttcagtataattgcacaaggagtctagataaaatattgtctaagaattgttatgtatgacaaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27602000 |
atcttaggtgttcttgtgtgaattattttcattttttcagtataattgcacaaggagtctagataaaatattgtctaagaattgttatgtatgacaaata |
27601901 |
T |
|
| Q |
219 |
tgcaatgttttgacttcagaggtggccaagcagtt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27601900 |
tgcaatgttttgacttcagaggtggccaagcagtt |
27601866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University