View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_46 (Length: 249)
Name: NF1490_low_46
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 26653255 - 26653493
Alignment:
| Q |
1 |
tcttgatgtctcgtaaataatggtagatcgtctctaatctctaacctctgatgttacgattaattacctaaaagagaaacattaagttccaacaatatgt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||| |||| ||||||||| ||||||| || |
|
|
| T |
26653255 |
tcttgatatctcgtaaataatggtagatcgtctctagtctctaacctctgatgttacgattagttacttaaaaaagaagcattaagtttcaacaatgtgc |
26653354 |
T |
|
| Q |
101 |
gtgattgtaaacgtagcccgacaagtgcccttgcctgttttccttacaagggatgtatgattctagcatgccccaaatcaaaagatcaatcaagggattt |
200 |
Q |
| |
|
|||||||||||| || ||||||| | ||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26653355 |
gtgattgtaaacctaatccgacaaatacccttgcctgttttccttataagggatgtctgattctagcatgccccaagtcaaaagatcaatcaagggattt |
26653454 |
T |
|
| Q |
201 |
tgatatgttgcataagtcgacttgatctacaagcctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26653455 |
tgatatgttgcataagtcgacttgatctacaagcctttg |
26653493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University