View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_47 (Length: 247)
Name: NF1490_low_47
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 15935746 - 15935689
Alignment:
| Q |
31 |
gttcgctcctttgggagccgttctatctttccttttccctcgtacaaatcgaattact |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935746 |
gttcgctcctttgggagccgttctatctttccttttccctcgtacaaatcgaattact |
15935689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 117 - 190
Target Start/End: Complemental strand, 15935660 - 15935587
Alignment:
| Q |
117 |
aaatactcgagcccgttgctttgaaggattttcttatttacagtttgtactctttctctttcttcttcatccca |
190 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
15935660 |
aaatactcgagccagttgctttgaaggattttattatttacagtttgtacttttactctttcttctgcatccca |
15935587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University