View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_51 (Length: 240)
Name: NF1490_low_51
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 4474835 - 4474617
Alignment:
| Q |
1 |
tttctttctcaaaattgttcaccaacattaccatacccttctttcgtcctttaaaaacccctacaccnnnnnnnnnnnnnnnatcataacatctttgagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4474835 |
tttctttctcaaaattgttcaccaacattaccatacccttctttcgtcctttaaaaacccctacaccctctctctctctctcatcataacatctttgagc |
4474736 |
T |
|
| Q |
101 |
caactataatctctatagctagctcaaccaaattccatattcccctcacaaaacatcttagcaaattaaactcatatttttcttccttcnnnnnnntttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
4474735 |
caactataatctctatagctagctcaaccaaattccatattcccctcacaaaacatcttagc-----aaactcatatttttcttccttcaaaaaaatttc |
4474641 |
T |
|
| Q |
201 |
ctccctttgtcatgggagcctttc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4474640 |
ctccctttgtcatgggagcctttc |
4474617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University